Ginivia @ the top. 😻
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~Ginivia
Jahseh
The boy that sits in the back of the class with his headphones in.
What is he listening to?
What is he thinking?
The world will never know...
But I was curious, I wanted to know.
"Alright, we're going to start on this assignment. I'm going to pair each of you guys up, and together you guys will complete this worksheet of decoding DNA." My teacher started to pass out the papers while pairing people up.
"Jahseh and Ginivia, you guys will be working together, so push your desk close to one another." She handed me two worksheets.
I turned to look toward Jahseh. His eyes fell upon mine.
"Are you gonna move toward me, or do you want me to come to you?" He just gave me a blank stare.
I sighed heavily, and moved my desk toward him.
I passed him a worksheet, and he just started working on it.
I put my name at the top, and looked down at the first problem.
Directions: Decode the following DNA during the phases of Transcription to Translation.
Transcription:
1. ATTCGGGCATAGCTTAGCATCGGG
I held my head in my hands and began to get frustrated.
How the heck do you do this?
I looked at Jahseh and saw that he was almost done.
I really need help, but I don't want to disturb him...
Just ask him.
I sucked in a breathe, and let it out.
I tapped him on the shoulder. "Um, could you help me with the first problem?" He gave me a blank look, while taking out his headphones.
I felt like he was staring into my soul, so I looked over to other side of the room.
"Sure... I'll help you." He picked up my worksheet and pointed to number one with his pencil.
"Okay, so Transcription... What is it?"
I knew this.
"Transcription is the process in which DNA transfers over to RNA. Right?"
He shook his head. "Correct. So, what's the one thing that RNA has that DNA doesn't?"
"RNA has Uracil, DNA has Thymine."
"Correct again. So, what does that mean?"
It took a few seconds but it finally clicked.
"It means that in Transcription all the A's are going to be turned into U's. Then all the T's are going to be turned into A's. And C will equal G's, and G's will equal C's." I looked up at him, and he gave me a side smirk.
"There ya go." He put the worksheet in front of me, and I continued to do the problems.
"Hey, thanks." He looked at me.
"No problem." I continued to stare at him.
His face looked so evil, yet it had beauty to it.
He had one tattoo under his eye, that read Numb.
What was he numb from?
I continued to study his face. He had tattoos of a broken heart and 3 dots.
What do they mean?
He sensed me staring.
"Take a picture, it'll last longer." The bell rang. He got up from his desk, turned his worksheet in to the teacher, and walked out the room.
I sat in there in awe.
He was locked down with secrets...
And I was going to be the one key...
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
Jahseh
12:00 P.M.
"Yo, you gotta secret admirer or something?" Ski bumped my shoulder, and I looked up into the cafeteria.
"Not any that I've heard of, why?"
"Because, it's a girl that keeps looking over here every second."
I looked over to the left of the cafeteria, and noticed that it was that girl from my Biology class.
I looked her way, and she immediately dropped her gaze.
I shook my head. "She was staring at me in class too. All I did was help her out with a worksheet."
"Maybe she think you cute. I mean you are kind of adorable..."
Wifi looked at him with a crooked face.
"Uhhh, excuse me. Did you really just?" Wifi shook his head, and continued to eat his Doritos.
I laughed loudly. "You calling me sexy man? You think I'm sexy... I think you kind of sexy too. I'll lick them face tats off your face."
"Who's mans is this?" Ski pointed towards me. Everybody started laughing at the table.
"We still recording tonight?" I drank some of my water.
"Yup, be at the studio at 8:00 sharp."
"Coolin. Is she still looking over here?" Ski looked over at her table and laughed.
"Every second vro. Tell you what, I see my friend Ayanna over there... Why don't we just invite them over for our studio session?" I looked at Ski like he was crazy.
"Nah, cause all she finna do is stare at me. I ain't got time for that." It was to late, anyway, because Ski had called his friend and that girl over to the table.
"Aye, we having a recording session at the studio tonight. How would y'all feel about coming?"
"What time?" His friend asked. The other girl was just hiding behind her.
"8:00 sharp."
"Cool, we'll be there." With that, they walked away. I slapped Ski on the head.
"What the hell man? I said don't invite them!"
"I don't give a damn! Who knows what might happen tonight. You may even enjoy yourself." He laughed loudly.
I slumped in my seat and crossed my arms.
Let's see what the hell happens.
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
Don't forget to vote and comment.Of course the first chapters are going to be getting to know the characters... So, action will be kind of happening, but we'll see.
Anyway, I've got some many ideas for this story... it's just amazing. ☄️✨💫
But, I hope that you guys have a good week.
If you on spring break, like me 😝😝, then I hope you have fun and jank.
Peace out, Girl Scouts.
~J. 💜
YOU ARE READING
Valentine (XXXTENTACION)
FanfictionRoses are red. Violets are blue. Ginivia... You knew I loved you. ~X. ?